Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite

This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing 5? thiolated 60-mer DNA aptamer (i.e., 5?-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3?). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on glassy carbon (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that PDMA–PVS–Ag0 nanocomposites were polydispersed contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of gave dynamic linear range (DLR) limit detection (LOD) values 0.01–0.1 ng L?1 MC-LR 0.003 MC-LR, respectively. The cross-reactivity studies, which validated with enzyme-linked immunosorbent assay (ELISA), showed possesses excellent selectivity MC-LR.